"Enzyme activities" 검색결과 141-160 / 1,404건

• 

  WGA(Whole genome amplification) 실험실습 보고서

  (반드시 진행)→만약 inactivation 단계를 거치지 않을 경우 Phi29 DNA polymerase의 activity로 amplification DNA가 Degradation된다 ... 실험과정 중 들어간 enzyme과 buffer들 때문에 순도는 낮아질 수밖에 없다. ... EM은 Enzyme mixture로 가장 중요한 중합효소와 효소들의 반응에 도움을 주는 Buffer들이 혼합되어 있는 것이다.

  리포트 | 2페이지 | 1,000원 | 등록일 2019.12.04 | 수정일 2021.07.14

  다운로드 장바구니
• 

  What the CRISPR/Cas9 is?

  restriction enzymes that can be engineered to cut specific sequences of DNA. ... (inactive Cas9 protein binds to the guide RNA and becomes activated) Target Binding (The activated guide ... F irst-generation gene editing technique ( Zinc Finger Nucleases, ZFNs) are artificial restriction enzymes

  리포트 | 10페이지 | 1,500원 | 등록일 2021.08.16

  다운로드 장바구니
• 

  대학 생화학 기출문제 및 족보 모음

  occur at a reasonable rate even without catalysis.촉매 없이도 생성물 형성이 적당한 속도로 일어납니다.2. the catalytically active ... Which of the following most accurately describes a mechanism by which enzymes catalyze reactions involving

  시험자료 | 11페이지 | 8,000원 | 등록일 2023.03.06

  다운로드 장바구니
• 

  [화학공학실험II] 바이오디젤 예비 보고서 (2020년 최신)

  . - 효소(enzyme) : 활성 부위에 기질이 결합하여 복합체를 형성, 화학 반응의 activation energy를 낮춰 반응 속도를 변화시킬 수 있다.

  리포트 | 2페이지 | 1,000원 | 등록일 2020.12.28

  다운로드 장바구니
• 

  Restriction

  l의 시약을 만든다. enzyme으로는 Xho I, EcoR I, Nde I를 넣는다. ... Restriction Enzyme(Nde l, Xho I, EcoR I)? PCR tube? Incubator? ... 만약 계면에서 용액을 퍼서 넣지 않을 경우 많은 양의 시약이 들어가 Star Activity가 일어난다.?

  리포트 | 7페이지 | 1,000원 | 등록일 2020.02.23

  다운로드 장바구니
• 

  미생물학testbank Q&A

  1 Mark)It acts as the site of electron transport and oxidative phosphorylation (1 Mark)It bears the enzymes ... by harmful bacteria. (1 Mark)Production of antimicrobial compounds by the indigenous microbiota that actively

  리포트 | 7페이지 | 1,000원 | 등록일 2020.06.24 | 수정일 2020.07.06

  다운로드 장바구니
• 

  분자생물학 연구방법론 필기자료

  가지고 있으며 동시에 3’5’ exonuclease activity를 가지고 있다. ... 이는 Restriction enzyme이 인식하는 부위에 해당하는 서열을 인식해 DNA를 메틸화 시킨다. ... 그러나 T4 pol의 exonuclease activity를 DNA Pol Ⅰ보다 200배는 더 강력하다.Joining of vector to insertAlkaline Phosphatase를

  시험자료 | 9페이지 | 2,000원 | 등록일 2020.12.31 | 수정일 2023.10.29

  다운로드 장바구니
• 

  HIV 클론항체의 생산

  The antibodies have various functions such as opsonistion, complement activation, antibody dependent ... degranulation and because of these, the antibodies have used for several purpose like vaccination and enzyme

  리포트 | 6페이지 | 3,500원 | 등록일 2021.08.03

  다운로드 장바구니
• 

  28도에서의 SNC1 단백질과 Nup96의 상관관계

  Vector 선택 및 제한효소 선택MCS 앞에 DNA-binding domain 서열을 갖는 pGBKT7 vector와 MCS 앞에 activation domain 서열을 갖는 pGADT7 ... Enzyme site 및 Frameshift 고려한 Primer Designspecific protein domain: TIR domain(aa19~195)SNC1’ cds primer1forward ... Enzyme site 및 Frameshift 고려한 Primer Designoverlapping sequence of the mutation site: TAATAGATAAAGAATCGTTCAAAGGE

  리포트 | 5페이지 | 2,500원 | 등록일 2024.06.02

  다운로드 장바구니
• 

  [충남대] 분자생물생화학실험 - 대장균 IPTG 처리, 크로마토그래피, 재조합 단백질 생산

  금요일 1조 specific activity표2는 금요일 1조의 specific activity 계산 결과를 정리한 표이다. 사용한 공식은 다음과 같이 계산하였다. ... (mg/ml)10/500 = 0.02specific activity6.903715.028815.42745activity 평균5.7867DES OD값1.6561.8511.956Sulfide ... (umol/ml)0.066590.074560.07885DES (mg/ml)1.5/1000 = 0.0015specific activity1.479761.656841.75219activity

  리포트 | 15페이지 | 5,000원 | 등록일 2024.04.17

  다운로드 장바구니
• 

  분자세포생물학 chapter13-16 요약

  분리된 receptor는 그 다음 Golgi나 plasma membrane으로 재순환되며, lysosomal enzyme은 lysosome으로 전달된다.- Secretory pathway를 ... .- Lysosome으로 보내질 soluble enzyme은 cis-Golgi에서 modify되어 그들의 oligosaccharide chain에 여러 개의 mannose 6-phosphate ... 이 enzyme에 의하여 cGMP level이 감소하면 cGMP-gated Na+/Ca2+ channel이 닫히게 되어, membrane은 hyperpolarization 되고 neurotransmitter의

  시험자료 | 13페이지 | 5,000원 | 등록일 2019.12.17

  다운로드 장바구니
• 

  Alginate Spheres에서 효모 세포의 캡슐화

  The activity of the yeast was observed by measuring the volume of gas which was carbon dioxide evolved ... A simple laboratory experiment for teaching enzyme immobilization. Biochemical Edu1 ... formed entrapping yeast in a three-dimensional lattice of ionically cross-linked alginate.Compare the activity

  리포트 | 6페이지 | 2,000원 | 등록일 2021.08.04

  다운로드 장바구니
• 

  진단검사 보고서, 검사결과 보고서, 피검사결과 해석, 피검사결과 의미, 성인간호

  중탄산염을 측정하는 경우 진공 용기에 채혈하며, 즉시 검사실로 보내도록 함.PT & PTT프로트롬빈 시간 &활성화 부분트롬보플라스틴시간(prothrombin time & activated ... ·인도메타신·코데인·몰핀 등의 약물 복용) 저지방식, 저칼로리식, 단백질 식이 증가, 육식위주의 식습관 개선, 금연, 금주, 화학물질에 대한 노출 감소가 도움이 됨.cardiac enzymes심장효소검사심근

  리포트 | 12페이지 | 1,000원 | 등록일 2024.01.10

  다운로드 장바구니
• 

  시르투인의 항암효과 PPT

  sirtuins have been discovered to regulate cancer cell metabolism , both by direct modulation of metabolic enzymes ... they regulate metabolism via posttranslational modification of various proteins, including metabolic enzymes.Mitochondrial ... Surprisingly, repression of Myc transcriptional activity by adding back SIRT6 into null cells does not

  리포트 | 35페이지 | 3,000원 | 등록일 2020.11.16

  다운로드 장바구니
• 

  DNAprep&WholegenomeAmplification

  높은 온도에서 activation할 수 있다.- proteinase K: DNA에 붙어있는 히스톤 단백질을 없애주는 역할을 한다. ... mixture): 반응에 도움을 주는 enzyme 혼합되어 있다.Phi 29 DNA polymerasePhi29 DNA polymerase는 Bacillus subtilis 를 숙주로 ... E. coli 에 발현하여 고순도로 정제한 재조합 단백질로 Taq DNA polymerase와 달리 Phi29 DNA polymerase만의 strand displacement activity

  리포트 | 5페이지 | 2,000원 | 등록일 2020.03.31

  다운로드 장바구니
• 

  참조기 내장에서 분리한 균주들의 옥신과 세포외 가수분해효소 활성 분석

  한국유산균학회 김명기, 이상재, 이용직

  논문 | 6페이지 | 4,000원 | 등록일 2023.08.14

  다운로드 장바구니
• 

  동물세포 및 발생공학 중간고사 정리

  생쥐2003: Began to sell GMO pet (Glofish)Gene targetingConstruction of targeting vector- Restriction enzyme과 ... β-galactosidase: X-gal + β-galactosidase → Blue color(dimer)Luciferase: Bioluminescence를 생산하는 Oxidative enzymes ... -CH3CO) in histone 을 사용하여 DNA 부분의 활동성이 변화하는 과정Acetylation → Modify Chromatin structure → Change the activity

  리포트 | 10페이지 | 1,500원 | 등록일 2021.11.15 | 수정일 2022.05.15

  다운로드 장바구니
• 

  Inhibitory Effects of S-Allylmercaptocysteine Derived from Aged Garlic on Cholesterol Biosynthesis in Hepatocytes

  한국식품위생안전성학회 Seung-Taek Yang

  논문 | 6페이지 | 4,000원 | 등록일 2023.04.05 | 수정일 2023.04.06

  다운로드 장바구니
• 

  마늘성분이 Lard 와 Alcohol 을 섭취한 흰쥐 혈청중의 효소활성에 미치는 영향

  한국식품위생안전성학회 변부형, 김석환, 정혜광, 남철현, 노병의

  논문 | 6페이지 | 4,000원 | 등록일 2023.04.05 | 수정일 2023.04.06

  다운로드 장바구니
• 

  pre report-용액의 pH 측정

  If pH changes sharply, it affects to the vital things like activation of enzyme so the buffer must be ... The electrolytes are important cause they act as cofactor that helps the activity of enzymes or controller ... the juice.2.Introduction#The reason that the pH balance is importantpH is the means that indicate the activity

  리포트 | 4페이지 | 2,500원 | 등록일 2022.06.10

  다운로드 장바구니